CDU-Werte-Union enthüllt: „Merkel war DDR,DDR,DDR“. Der unheimliche Grund, weshalb sie als Kanzlerin gekürt wurde war den Politikern damals schon klar

Nun enthüllen Merkels Parteigenossen, dass diese Dame DDR,DDR, DDR war:
Der wirkliche Grund warum diese unbedeutende FDJ-Sekretärin Kanzlerin wurde

Spiegel 18.Jan. 2022  Der Vorsitzende der konservativen WerteUnion, Max Otte, hat die frühere Bundeskanzlerin Angela Merkel scharf attackiert. »Die Dame war durch und durch DDR, sie war Apparatschik, sie war Funktionär, sie war völlig sozialisiert im Sozialismus«, sagte Otte am Montagabend über die langjährige CDU-Vorsitzende.

»Es ist mir bis heute noch unfassbar, dass ein ganzes Land sich hat von ihr – 16 Jahre oder länger sogar – täuschen lassen. Das ist ein unglaubliches Meisterwerk, was sie da vollbracht hat und das ist ein Zerstörungswerk.«

Otte bezog dies auf die Energiewende, die Eurokrise, Migration und die Coronapandemie.
Die WerteUnion bezeichnet sich selbst als konservative Basisbewegung innerhalb von CDU und CSU mit rund 4000 Mitgliedern.

 »Dieses Land treibt in undemokratische Zustände«, sagte Otte. Die Meinungsfreiheit sei eingeschränkt. »Wir sind in einer Kulturrevolution.«

Hans-Georg Maassen: »Da gibt es eine Steigerung. Zuerst ist man ein Schwurbler, dann ein ›Querdenker‹, dann ein Rechtspopulist, dann ein Rechtsradikaler, dann kommt man zum Faschisten, Nazi, und dann ist man der Antisemit«, sagte Maaßen dabei unter anderem. »Ich glaube, wenn man in Deutschland der Antisemit ist, das ist in diesem Land der allerallerschwerste Vorwurf, den man machen kann, dann ist man überhaupt aus dem demokratischen Diskurs ausgeschlossen.«

Bemerkung
Warum nun diese Maassen-Hindeutung? Ist Merkel wirklich Jüdin, wie von vielen behauptet?

Ich habe kürzlich über das Unheil geschrieben, das Merkel über Europa gebracht hat. Und ich habe mich gewundert, wie diese unbedeutende Sekretärin in der FDJ – mit der Aufgabe die Jugend zu fanatischen Kommunisten und Feinden des Westens zu erziehen im Handumdrehen  Kultusministerin und dann  Kanzlerin im wiedervereinigten Deutschland werden konnte. Ich schrieb u.a.:

„Unter dem Einfluss der SED galt die Freie Deutsche Jugend auch als Kaderschmiede für den elitären Führungsnachwuchs. Die Stasi nutzte die Vereinigung, um Informationen für ihre Arbeit zu erlangen.

Unten: Glückliche Angela Merkel in der Uniform der Freien Deutschen Jugend (FDJ)

Merkel-fdj„In ‚Agitation und Propaganda‘ war man für Gehirnwäsche im marxistischen Sinne verantwortlich„, sagte Günther Krause dem Spiegel.

„Das war ihre Aufgabe, nicht Kulturarbeit, das war die Gruppe, die mit allen weltanschaulichen Tricks die Aufgabe hatte, die Köpfe der Menschen mit allem zu füllen, woran man in der DDR glauben musste.“

Illuminismus ist Kommunismus und hat die kommunistische  Eine-Weltherrschaft  als Ziel– siehe auch unten:

Die EU hat sich voll zum Illuminismus/Kommunismus bekannt und ihn durch die Annerkenneung der Agenda 21 und hier (Später Agenda 2030) schon teilweise eingeführt – ich habe die Kopie unten.

Europäisches Parlament 5. Okt  –  A6-0356/2007, S. 29 Explanatory Statement (nun sind verständlicherweise alle Seiten einschl. die aktuelle S.29  des peinlichen  Dokuments bis einschl. S.31  gelöscht).

Auf S. 29 stand als Einführung:
Es ist schon eine ganze Weile her, dass die Europäische Union nicht mehr nur ein gemeinsamer Wirtschaftsraum ist und begann, auch gemeinsame Werte  zu übernehmen. Sie nähert sich ihrem Ziel des Aufbaus
 einer politischen Gemeinschaft, die das illuministische Ideal verfolgt“.

Dies ist so wichtig, dass ich auch den englischen Text wiedergebe:

It is now quite some time since the European Union ceased to be merely a common economic area and began to adopt shared values as well. It is progressing towards its aim of establishing a political community pursuing the illuminist ideal“

ES GEHT UM DEN EINE-WELT-STAAT MIT DER EINE-WELTREGIERUNG

DIE EU SCHREIT NACH DIESER NEUEN WELTORDNUNG 

UND  FÜR DIE ABWICKLUNG DES NATIONALSTAATS DEUTSCHLAND WAR DIE KOMMUNISTIN UND JÜDIN MERKEL EINE GENIALE WAHL!

Merkel-destroying-europe

Ihr Vater  Horst war mit dem jüdischen Namen Kasmierczak geboren – änderte den Namen auf Kassner (warum?)

Merkel-666Links macht sie das freimaurerische 666-handzeichen für den Antichristen

Der Kommunismus wurde von 2 Juden, Weishaupt und Mayer Amschel Rothschild,  als der Illuminismus gegründet, vom  Juden Karl Marx ausgefeilt sowie von den  Juden Trotzky, Lenin und Stalin durch die bolshewistische Revolution eine Pest für die Welt.

Ob genetisch oder nicht: Jedenfalls ist Merkel im Herzen eine Jüdin.

Eine Unzahl von Rabbinern haben behauptet, das Judentum Kommunismus sei.

Ist das der Grund für Merkels sonst unverständlichen Aufstieg zur Macht und den Sturz von Helmuth Kohl durch einen FAZ Zeitungsartikel einer eingefleischten, aber diskreten  Kommunistin?

Ehemaliger chinesischer Verteidigungsminister 2003: Herrenvolk-Chinas Kommunistpartei brauche USA als Lebensraum um zu überleben. Mittel: Biowaffen-Ausrottung der Amerikaner -700 Millionen tote Chinesen ohne mehr Lebensraum oder in Nuklerkrieg gleichgültig. Westliche Illuminaten: Weg mit 80% der Weltbevölkerung

Epoch Times 9 May 2021:   Am 7. Mai enthüllte The Australian die Existenz einer chinesischen Militärzeitung aus dem Jahr 2015, in der die   SARS-Coronaviren als Biowaffe diskutiert wird -nun COVID-19.
In dem Papier sagen chinesische Militärwissenschaftler und hochrangige chinesische „öffentliche Gesundheitsbeamte“ voraus, dass der Dritte Weltkrieg, falls er kommt, durch neue biologische Waffen entschieden werde   Die Zukunft des Krieges sei biologisch, argumentieren sie.
Eine spezifische ethnische genetische Angriffstechnologie wäre eine biologische Waffe, die auf eine bestimmte ethnische Zugehörigkeit abzielt.
Die chinesische Militärstudie beschreibt SARS-Coronaviren als Grundlage für eine „neue Ära genetischer Waffen“, so ihre Autoren.”

Dieser Plan geht auf das jahr 2003 zuruck – auf eine Ansprache eines chinesischen Generals und ehemaligen Kriegsministers, Chi Haotian, Oberbefehlshabers  beim Massaker auf dem Platz des Himmlischen Friedens.
Eine Abschrift der Rede wurde 2005 von der Epoch Times erhalten und veröffentlicht.
Epoch Times bringt unter diesem Link nochmals einen Auszug aus der Ansprache

Jedoch, da mehr darin ist, bringe ich hier meinen erschütrernden Auszug: Docs Google .

Bevor ich  Haotians Ansprache von vorne in Auszügen zitiere, will ich zuerst das Ende seiner Ansprache zitieren: Das ist ganz im Geiste der Illuminaten zu denen die chinesische Führung gehört.
China ist in der globalen kommunistischen eine-Weltregierung Agenda 2030 eine führende Rolle zugedacht:  „The United Nations is keen to have China as a leading partner in this world-historical endeavour“.

US-VERSCHWÖRUNG
Genosse He Xin wies in einem Interview mit der Hong Kong Business News darauf hin: „Die USA haben eine schockierende Verschwörung.“ Nach seinen Angaben versammelte die von den Vereinigten Staaten finanzierte Michail-Sergejewitsch-Gorbatschow-Stiftung vom 27. September bis zum 1. Oktober 1995 500 der weltweit wichtigsten Staatsmänner, Wirtschaftsführer und Wissenschaftler, darunter George W. Bush (der war damals noch nicht  US-Präsident), die Baroness Thatcher, Tony Blair, Zbigniew Brzezinski, aber auch George Soros, Bill Gates, der Futurist John Naisbitt usw. im San Francisco Fairmont Hotel für eine hochrangige Konferenz am Runden Tisch, bei der Probleme der Globalisierung diskutiert wurden, und wie die Menschheit geführt werden kann, um ins 21. Jahrhundert voranzukommen. Laut dem, was He Xin zur Hand hatte, dachten die Anwesenden, dass im 21. Jahrhundert nur 20% der Weltbevölkerung ausreichen würden, um die Weltwirtschaft und den Wohlstand aufrechtzuerhalten. Die anderen 80 Prozent oder 4/5 der Weltbevölkerung werde menschlicher Abfall sein, die keine neuen Werte hervorbringen können. Die Anwesenden dachten, dass diese über 80-prozentige Bevölkerung eine Müllpopulation wäre und mit „High-Tech“-Mitteln schrittweise beseitigt werden sollte.

So fängt die Ansprache in ihrer Grausamkeit an:

Kameraden,
Ich bin heute sehr gespannt, denn die groß angelegte Online-Umfrage sina.com, die für uns durchgeführt wurde, hat gezeigt, dass unsere nächste Generation sehr vielversprechend ist, und dass die Sache unserer Partei weitergeführt wird. Auf die Frage „Werden Sie auf Frauen, Kinder und Kriegsgefangene schießen?“ antworteten über 80% der Befragten mit Ja und übertrafen damit unsere Erwartungen bei weitem.

Anscheinend geht es uns hauptsächlich darum, herauszufinden, wie die Einstellung des chinesischen Volkes zum Krieg ist: Wenn diese zukünftigen Soldaten nicht zögern, auch Nichtkombattanten zu töten, werden sie natürlich doppelt bereit und rücksichtslos sein, Kombattanten zu töten. Daher können die Antworten auf die Umfragefragen die allgemeine Einstellung der Menschen zum Krieg widerspiegeln.

Wie jeder weiß, ist die Essenz des Denkens des Genossen Xiaoping „Entwicklung ist die harte Wahrheit“.

Tatsache ist, dass sich unsere „Entwicklung“ auf die große Wiederbelebung der chinesischen Nation bezieht, die natürlich nicht auf das Land beschränkt ist, das wir jetzt haben, sondern die ganze Welt umfasst.

Hitlerdeutschland hatte einst damit geprahlt, dass die deutsche Rasse die überlegenste Rasse der Erde sei, aber Tatsache ist, dass unsere Nation den Deutschen weit überlegen ist.

Unsere Chinesen sind klüger als die Deutschen??, weil unsere Rasse der ihren grundsätzlich überlegen ist. Auf dieser Grundlage haben uns unsere Vorfahren die beiden wichtigsten Erben hinterlassen, nämlich den Atheismus und die große Einheit. 

Den Lebensraum des Landes fest erfassen: Die Kontrolle der Partei über die Nation fest an sich reißen; und die allgemeine Richtung festhalten, um der „Herr der Erde“ zu werden.

Unsere Umwelt ist miserabel – viel schlimmer als die des Westens.
Ob wir das chinesische Volk für immer vertreten können, hängt davon ab, ob es uns gelingt, das chinesische Volk aus China hinauszuführen.

Nur wenn wir unsere entwickelte nationale Stärke in die Kraft eines ersten Schlags nach außen verwandeln – nur indem wir die Menschen dazu bringen, hinauszuziehen – können wir die Unterstützung und Liebe des chinesischen Volkes für die Kommunistische Partei für immer gewinnen . Unsere Partei wird dann auf unbesiegbarem Boden stehen,

Bei unserer wirtschaftlichen Entwicklung dreht sich alles darum, sich auf die Bedürfnisse des Krieges vorzubereiten! In Wirklichkeit hat die wirtschaftliche Entwicklung den Krieg als ihr Zentrum!

Wenn wir, die KPCh, fertig sind, wird China fertig sein und die Welt wird fertig sein. Die historische Mission unserer Partei besteht darin, das chinesische Volk dazu zu bringen, hinauszuziehen.

Chinas große wirtschaftliche Expansion wird unweigerlich zu einer Schrumpfung des Pro-Kopf-Lebensraums für das chinesische Volk führen, und dies wird China dazu ermutigen, sich auf die Suche nach neuem Wohnraum nach außen zu wenden.  Chinas große wirtschaftliche Expansion wird unweigerlich mit einer bedeutenden Entwicklung unserer Streitkräfte einhergehen und Bedingungen für unsere Expansion nach Übersee schaffen.

Nur Länder wie die Vereinigten Staaten, Kanada und Australien haben das riesige Land, um unseren Bedarf an Massenkolonisierung zu decken.

Dies macht es uns möglich, dass viele Menschen dorthin migrieren und sogar ein weiteres China unter der gleichen Führung der KPCh gründen. Amerika wurde ursprünglich von den Vorfahren der gelben Rasse entdeckt, aber Columbus würdigte die weiße Rasse. Die Nachkommen der chinesischen Nation, haben Anspruch auf den Besitz des Landes! Wir müssen sie befreien. Langfristig ist das Verhältnis zwischen China und den Vereinigten Staaten ein Kampf auf Leben und Tod.

Nur durch den Einsatz spezieller Mittel zur „Säuberung“ Amerikas werden wir in der Lage sein, das chinesische Volk dorthin zu führen.
Entscheidende Mittel einsetzen, um Amerika zu „säubern“, und Amerika für unseren sofortigen Gebrauch reservieren.
Wenn die Vereinigten Staaten als Anführer weg sind, dann müssen sich andere Feinde uns ergeben.

CHINAS GROSSER ZUSAMMENBRUCH
Einige Genossen sahen Probleme, die unser Land überschwemmten – das Korruptionsproblem, das Problem der staatlichen Unternehmen, das Problem der schlechten Konten der Bank, Umweltprobleme, Probleme der Gesellschaftssicherheit, Bildungsprobleme, das AIDS-Problem, verschiedene Probleme mit Berufungen, sogar das Problem der Unruhen.

Wenn das chinesische Volk an das jetzige Land gebunden bleibt, wird zwangsläufig ein totaler gesellschaftlicher Zusammenbruch stattfinden. Nach Berechnungen des Autors von Yellow Peril werden mehr als die Hälfte der Chinesen sterben, und das wären mehr als 800 Millionen Menschen!  Dieses gelbe Land hat die Grenze seiner Kapazität erreicht.

BIOWAFFEN
sind in ihrer Rücksichtslosigkeit beispiellos, aber wenn die Amerikaner nicht sterben, müssen die Chinesen sterben
In den letzten Jahren haben wir an genetischen Waffen geforscht, also an Waffen, die gelbe Menschen nicht töten. Aber mit dieser Art von Forschung ein Ergebnis zu erzielen, ist äußerst schwierig.
Von der Forschung an genetischen Waffen auf der ganzen Welt ist Israel am weitesten fortgeschritten. Seine genetischen Waffen sind darauf ausgelegt, Araber anzugreifen und die Israelis zu schützen.

In der chinesischen Geschichte haben bei der Ersetzung von Dynastien immer die Skrupellosen gewonnen und die Wohlwollenden immer versagt.

Wenn unsere biologischen Waffen bei dem Überraschungsangriff erfolgreich sind, wird das chinesische Volk in der Lage sein, seine Verluste im Kampf gegen die Vereinigten Staaten auf ein Minimum zu beschränken. Sollte der Angriff jedoch scheitern und eine nukleare Vergeltung der Vereinigten Staaten auslösen, würde China vielleicht eine Katastrophe erleiden, bei der mehr als die Hälfte seiner Bevölkerung umkommen würde. Jedoch, wir können zum Wohle unserer Partei und unseres Staates und der Zukunft unserer Nation nur furchtlos voranschreiten, ungeachtet der Schwierigkeiten, denen wir uns stellen müssen, und der Opfer, die wir bringen müssen. Die Bevölkerung kann, selbst wenn mehr als die Hälfte stirbt, reproduziert werden.
Aber wenn die Partei fällt, ist alles weg und für immer weg.

„Experten“- und Medienlügen schmelzen im Strom der Wahrheitserscheinungen: Wer Gestern Verschwörungstheoretiker war, ist heute der Glaubwürdige! Russische Falschflaggen seien echt – unzählige US-„Schwarze Schwäne“ seien „Verschwörungstheorien“

Gestern könnte die Menschheit nur durch 2 kolossal effektive Impfungen gerettet werden: Man wäre dadurch vor Covid19 und Virusübertragung gefeit!
Die menschen haben diese Lüge geglaubt – und nun sind 87% der „Omicron“-steckten geimpft. Also noch eine 3. Impfung nach 4-5 Monaten und in Israel sowie bei Alten noch eine 4. Spritze – usw. Denn Pfizer-Boss Bourla sagt, Omicron mache die bisherigen Impfungen wirkungslos (was sie von vornherein waren) – und BioNtech Boss sagt, es seien ganze 3 Omicron-Impfungen nötig, um die Pandemie zu stoppen!

Pandemie-Erfinder Chr. Drosten: So geht es nicht weiter!

ZDF 16. Jan. 2022: Dazu äussert sich nun der Pandemieerfinder (durch seine total unbrauchbaren und in den USA und Schweden daher abgeschafften PCR-Test, ohne den es keine Pandemie gäbe). Dieser göttliche Betrüger, der auch seinen Doktorgrad durch Betrug erlangte, gibt nun endlich zu, dass man die Menschen nicht alle 3 Monate weiterhin impfen kann: Nun müssen die Viren uns aus unsere slbstgemachte klemme retten, und zwar mit dem, was man von Anfang an hätte tun sollen: Wie bei allen früheren Grippen Herdenimmunität anstreben.

Die WH
The Defender: Die Technical Advisory Group on COVID-19 Vaccine Composition (TAG-CO-VAC) der Weltgesundheitsorganisation (WHO) warnte am 11. Januar: „Eine Impfstrategie, die auf wiederholten Auffrischungsdosen der ursprünglichen Impfstoffzusammensetzung basiert, ist unwahrscheinlich angemessen oder nachhaltig.“

Die Expertengruppe, die von der WHO eingesetzt wurde, um die Leistung von COVID-Impfstoffen zu bewerten, sagte, die Bereitstellung neuer Dosen bereits vorhandener Impfstoffe, wenn neue Virusstämme auftauchen, sei nicht der beste Weg, um eine Pandemie zu bekämpfen.

Die EU
Bloomberg 11. Jan. 2022: Die Aufsichtsbehörden der Europäischen Union warnten davor, wiederholte Auffrischungsdosen alle vier Monate könnten laut der Europäischen Arzneimittelagentur (EMA) die Immunantwort schwächen und die Menschen ermüden.
Vakzine sollten eine breite, starke und lang anhaltende Immunantwort hervorrufen, was die Gängigen eben nicht tun.

Grossbritannien
The Guardian 8. Jan. 2022: COVID als endemisches Virus sollte ähnlich der Grippe behandelt und die Massenimpfung nach der Auffrischungskampagne beendet werden, sagte Dr. Clive Dix, ehemaliger Vorsitzender der britischen Impfstoff-Task Force.

Falschflaggen
Activist Post 16 Jan. 2022 Der Pressesprecher des Weißen Hauses, Jen Psaki, sagte am Freitag vor Reportern: „Uns liegen Informationen vor, die darauf hindeuten, dass Russland bereits eine Gruppe von Agenten vorpositioniert hat, um eine Operation unter falscher Flagge in der Ostukraine durchzuführen, eine Operation, die wie ein Angriff auf sie oder ihre Leute oder russischsprachige Menschen in der Ukraine aussehen soll, als Vorwand, um hineinzugehen.“ Der Sprecher des Pentagon, John Kirby, sagte der Presse am Freitag das Gleiche– auch unter Verwendung des Wortes „Falsche Flagge“.

Kommentare
So was wurde alles früher verächtlich als „Verschwörungstheorie“ zurückgewiesen. Aber die Wahrheitswelle lässt sich nicht stoppen -und nun müssen die Volksverführer allmählich mit dem Strom fliessen: Sie können ihre Lügen nicht viel länger vertuschen.

Sehen Sie , was das oberste Sprachrohr der Illuminaten-Elite, The Washington Post am 27. Okt. 2018, darüber schrieb:
1. Wir haben in den USA viele Verschwörungstheorien unter falscher Flagge gesehen.
2.Verschwörungstheorien unter falscher Flagge sind beliebt
3. Überzeugungen unter falscher Flagge stimmen mit den politischen Ansichten der Menschen überein
4.Verschwörungstheorien unter falscher Flagge können unbeabsichtigte Folgen haben
5.Es gibt eine Psychologie hinter Verschwörungstheorien unter
falscher Flagge

Fakten werden diese Theorien nicht beenden. Selbst mit einem möglichen Schuldigen in der Hand werden wahrscheinlich zumindest einige Anhänger weiterhin Theorien glauben, die die andere Seite beschuldigen, egal welche Beweise in die andere Richtung weisen“.

Verschwörungstheoretiker sind immer Gegner des Regimes, das sich den taat nennt. Niemals wird en Anhänger der neuen Weltordnung „Verschwörungstheoretiker benannt: Denn er ist Verschwörungspraktiker. Die ganze Geschichte der Menschheit ist eine lange Kette von Verchwörungen.

Nun beginnt also im Weissen Haus der Wind sich zu wenden.
Aber notgedrungen:

Genau die USA und ihre Nachrichtendienste sind Urheber der grössten Serie der falschen Flaggen der Geschichte!

So schrieb Prof Uscinski in The Post als Beleg dafür, dass es Verschwörungstheorien über Falschflaggen hinter vielen schmutzigen Ereignissen gibt:Dies sind nicht einfach Kreationen des Internets. Nicht lange nach dem japanischen Angriff auf Pearl Harbor im Jahr 1941 beschuldigten Verschwörungstheoretiker Präsident Franklin D. Roosevelt, den Angriff zugelassen zu haben, um widerwillige Amerikaner davon zu überzeugen, sich am Zweiten Weltkrieg zu beteiligen.

Das ist aber ein sehr schlecht gewähltes Beispiel
– es zeigt gerade, wie hirnblind die Elitisten-Mitläufer sind: Eben diese historische „Verschwörungstheorie“ hat sich bewahrheitet:
The Independent Institute 11. März 2002 dokumentiert auf der Basis von Aussagen und Robert Stinnetts Buch „Day Of Deceit“, dem zugrunde 16 Jahre Studien von 200.000 Dokumenten im US-Nationalarchiv liegen, dass Präs. Franklin D. Roosevelt zweifelsohne über den bevorstehenden Angriff auf Pearl Harbour 1941 Bescheid wusste und ihn nicht verhinderte – sowie dass er der Engineer hinter dem Angriff war.
Die Amerikaner hatten den japanischen Code geknackt und hatten alle Admiral Yamamotos Angriffsbefehle gegen Hawaii erfasst.

Das US-Imperium baut eben auf einer langen Reihe von Falschflaggen/“Conspirationstheorien“ aber erst nun erklärt das Weisse Haus also, dass es überhaupt so was wie „Verschwörungstheorien“ als Fakten gibt

Alles, um für eine kleine Elitenclique die Macht über uns „unnützen Esser“/Gojim (Vieh) zu erlangen

Moderna entwickelte ein für Krebsproteinproduktion bezogenes CoV2 (Covid19) Virusgen durch Einsetzung von 4 HIV/AIDS-Virus-Sequenzen in das Spikeprotein des SARS-Virus – und suchte Patent für das Produkt 2017!


Indische wissenschaftler hatten aus Wuhan eine „Covid19“-Virusprobe erhalten – und fanden im Spikeprotein dieses Virus 4 HIV-(AIDS)-Virussequenzen -> VAIDS? Ich las den Originalartikel, worauf  dieser Artikel gleich  vom Internet  gelöscht wurde – aber es gibt eine PDF-Kopie.

Das Folgende wird mittels minutiöse Studien in der Datenbank des US-Nationalen Instituts für Gesundheit (NIH) überzeugend  nachgewiesen und ist eine bemerkenswerte detektivische Enthüllung des Ursprungs des „Covid19-Virus“, dessen Existenz kein nationales Vakzin-Amt hat nachweisen können/gewagt

Die Untersuchung basiert auf einer Studie von  Dr. Ah Khan Syed .

Das SARS-CoV-2-Genom (Covid19) enthält eine ungewöhnliche Nukleotid/Kernbasen-Sequenz, die nirgendwo sonst in der Natur vorkommt

DAS PATENT FÜR DIESES SARS-HIV-GESPLEISSTES PRODUKT (COVID19) WURDE NACHWEISBAR 2017 VON MODERNA BEANTRAGT: DAS „COVID19“- VIRUS IST MENSCHENGEMACHT

Punch News 16. Jan. 2022: BLAST ist unter anderem das NCBI/NIH-Lager (auch  als das der US-Regierung bekannt) für Gen- und Proteinsequenzen.
Hier hinterlegen alle Genomforscher weltweit ihre Sequenzen, wenn sie eine Entdeckung machen.

Gensequenz ist eine Codezeile, die aus einer beliebigen Kombination von 4 Buchstaben in einer Folge besteht. Die 4 Buchstaben stehen für die 4 Kernbasenbausteine/Nucleotide der  DNA und RNA.

BLASTp behandelt Aminosäuresequenzen genauso wie BLASTn  Kernbasensequenzen

Hier ist, wie die Genom-Suche in der BLAST-Datenbase auf eine der kurzen Gensequenzen des „Covid19-Virus“ (TNGTKR) läuft

In [1] müssen Sie Ihre gewünschte Aminosäuresequenz eingeben. Wir werden uns auf nur 4 Sequenzen innerhalb des viralen Genoms/Proteoms von SARS-CoV-2 (Covid19) konzentrieren, und diese sind für uns in Prashant Pradhan et al.s Artikel „Uncanny similarity of unique inserts in the 2019-nCOV  spike protein to HIV-1 gp120 and Gag“ (Unheimliche Gleichheit des Einsatzes  in das  2019-nCoV Spikeprotein mit HIV-1 gp120 und Gag – mit CRISPR gemacht), zu finden,  am 31. Januar 2020 veröffentlicht, wenige Tage nach der Veröffentlichung der Covid-Genomsequenz.

Die 4 erwähnten Einsätze sehen Sie in Prashant Pradant et al.´s Tabelle 1.
In der Suche oben hat Dr. Syed die Einsatz-Sequenz 1 eingefügt

Sie erhalten (unten) eine Liste von Kandidaten, die eine enge Ähnlichkeit zu der gesuchten Sequenz aufweisen. Da es sich um eine sehr kurze Sequenz handelt, sollte die Ähnlichkeit 100 % betragen.
Was Sie sofort sehen werden, sind ganz oben auf der Liste zwei synthetische Viren, die eine Spleissung  von SARS-Cov-2 und einem anderen Virus sind, die in den letzten 2 Jahren in Labors aufgetaucht sind, die mehr Viren hergestellt haben. Darunter ist eine ganze Reihe von Hinweisen auf HIV-1.

Sie werden sehen, wenn Sie die Seite hinuntergehen, dass die Ausrichtungen nur   für HIV-1 gelten, bis Sie anfangen, synthetische und hypothetische Proteine zu bekommen,   bis das nächste echte Virus in der Liste, das HIV-2 ist …

Syed sucht weiter

Wollen wir zu den nächsten 3 Sequenzen übergehen . Wir können einen Filter für kurze Sequenzen setzen, um sicherzustellen, dass die Sequenz 100% (bindungsfähig) übereinstimmt. Denken Sie jetzt daran, dass, wenn die (bindungsfähige) Übereinstimmung mit HIV-1 zufällig wäre, wir keine Übereinstimmung auf der Liste sehen sollten.

Alles, was uns bleibt, sind die synthetischen Viren von Nach-Covid und RaTG13 (ebenfalls Nach-Covid).

Syed sucht weiter

Das einzige verbleibende Virus in der Liste ist, Sie haben es erraten, HIV-1. Wie hoch ist die Wahrscheinlichkeit, dass HIV-1 bei allen  Suchvorgängen auftaucht?

Wir haben also 4 (bindungsfähige) Übereinstimmungen (des SARS-Virus) mit HIV-Sequenzen, wobei keine anderen Viren* in allen 4 (bindungsfähigen) Übereinstimmungslisten (mit dem SARS-Virus) erscheinen (*mit Ausnahme von synthetischen, die nach dem Ereignis erstellt wurden). Wie stehen die Chancen eines Zufalls dafür? – nahe Null.

In ihrer Arbeit gingen  Pradhan et al. noch weiter und illustrierten die Struktur des Virus mit der Anhaftung der vier Einsätze. Diese „zufälligen“ Einsätze“ – alle von HIV/AIDS-Virus – befinden sich alle an Bindungsstellen des Coronavirus.

Jetzt gehen wir zurück zu den Kernbasen, den G-A-C-Ts, die die Sequenz bilden, die für die Aminosäuren kodiert, über die wir bisher gesprochen haben. Die ursprüngliche Referenzgenomsequenz für das Coronavirus hat die Genbank-ID NC_045512.1 und kann hier gesehen werden:

Syed führt  Suche auf diesen Code an an und kommt zu dieser Ausschrift:

In diesem speziellen Abschnitt sehen Sie, dass es sich um eine Sequenz des „Spike-Proteins“ (Oberflächen-Glykoprotein) handelt, und die Nukleotide sind mit 23548…23771 gekennzeichnet.

Nun, das ist wirklich interessant, denn wir haben nicht nur gesehen, dass der QTNS-Abschnitt von HIV stammt, sondern das angrenzende PRRAR hat etwas ganz Besonderes, denn das ist eine Furin-Spaltstelle, und wie wir gesehen haben, existiert dieser  Typ des SARS-ähnlichen Virus nicht. Es ist ein Einsatz in das virale Genom.

Die Genomsequenz, die Sie für diese Aminosäuresequenz sehen können, lautet: CAGACTAATTCTCCTCGGCGGGCACGTAGT, was aus 30 Nukleotiden besteht, die für 10 Aminosäuren codieren. Dass diese Folge zufällig entsteht, wäre  unendlich unwahrscheinlich, also muss sie irgendwo entstanden sein.

Syed sucht weiter:

Wir sehen, dass die einzigen viralen Sequenzen hier synthetisch sind, und wenn Sie auf jede dieser Sequenzen klicken würden, würden Sie ihr Registrierungsdatum nach Februar 2020 finden. Mit anderen Worten, kein natürliches Virus drin  hat diese genetische Sequenz.

Syed sucht weiter und folgert:
Vor der Entdeckung von SARS-Cov-2 ist dem Menschen kein Virus bekannt, das diese bestimmte Sequenz in seinem Genom aufweist.

Syed sucht weiter in der BLAST-Datenbank:

Ich habe gerade die ersten drei hervorgehoben, aber die ganze Liste  sind Patente, die demselben Unternehmen gehören, Sie müssen nur rechts auf die Zugangsnummer klicken

Wo kommt  nun  diese erste GEN-Patentnummer LZ959695.1 her?

ES IST ALSO EIN MODERNA GEN-PRODUKT FÜR DIE PRODUKTION VON KREBS-BEZOGENEN PROTEINEN UND PEPTIDEN – 2 JAHRE VOR DER PLANDEMIE  ENTWICKELT.

 

US-CDC: US-Übersterblichkeit verdoppelte sich mit 415.500 von 2020 bis 2021 – wie 75% geimpft wurden. Sterberate viel höher unter Jüngeren 2018 als im Coronajahr 2020!

Wie ich kürzlich schrieb, ist plötzlich die Anzahl der „Covid19-Fälle“ senkrecht mit Raketenfahrt in die Höhe geschossen – und es sind zu 90% die Geimpften, die infiziert werden.

Unten von Our World in Data

Die Politiker, Gesundheitsbehörden und Medien predigen weiterhin die kolossale Effekktivität der Genmanipulations-Spritzen, agitieren nun allmählich sogar für den 4. Stich in einer unendlichen Serie – indem Die „Impfungen“ gar nicht effektiv sind. Sie sind wirkungslos und hier und hier  und hier, z.B.- und der „Efferkt“ reiche laut The Lancet  schon nach 6-10 Wochen nicht aus.

Jedoch die Sterblichkeit in der jetzigen Omicron-Epidemie scheint gering zu sein.

Wie ist es aber bislang mit der Sterblichkeit in den beiden Coronajahren 2020 und 2021 verlaufen?
Nehmen wir uns die USA als  Beispiel – obwohl auf der Sterbeurkunde dort 90% der Todesfälle als Covid19 bezeichnet werden (unten).

Dafür sind die Gesamttodesfälle der USA um so interessanter:
Centre for Evidence Based Medicine 3. März 2021:  Im Coronajahr 2020 war in den USA die Mehr-Sterblichkeit im Vergleich zu dem Durchschnitt der vorhergehenden 5 Jahre 12,9%. Jedoch,  diese Entwicklung verstärkte sich leider stark im Impfjahr 2021 – obwohl man uns das Gegenteil versprochen hatte  

Unten folgt der Todesdurchschnitt  Jan.2020-Jan.2022 im Vergleich zum vorhergehenden 5-Jahresdurchschnitt: Sie sehen vom Abschluss des ungeimpften Coronajahrs 2020 zum Abschluss des Impfjaehrs 2021 einen grossen  Anstieg der Gesamtsterbefälle von 453.000 – obwohl nun 75% der US-Bürger nun midestens 1-mal geimpft 

Wenn wir die grosse Steigerung der Mehr-Sterbefälle im Vergleich zum „gefährlichen“ unbehandelten Coronajahr 2020 betrachten,  stellt sich heraus, dass die Impfungen eher todbringend sind.
Merken Sie sich: In 90% der Totenscheine stand „Covid19“ als Todesursache!!!


Man sieht  nach dem 1. Impfjahr eine deutliche Verschiebung der Sterblichkeit weg von den Alten auf die jüngeren Bevölkerungsgruppem

 Dies ist eine Wende  der  Sterbefälle, wie sie sich nach Alter bis zum Cornajahr 2020 laut Our World Today gobal entwickeln:

Unten nun  Detaillierte US Sterbefälle nach Alter für die 2020-2022 laut den US-CDC: Insgesamt 573.646 Sterbefälle. On March 31, 2021, this report was posted online as an MMWR Early Release. Jedoch die Zahlen unten sind die Gleichen wie für das Jahr 2020 allein!! Also ist 2021 vorläufig ausgelassen.

Übrigens zeigt sich beim Vergleich mit dem Schlimmen Influenzajahr 2018 zum Coronajahr 2020 etwas sehr interessantes: Die Sterberate in der jungen Bevölkerungsgruppe 15-45 Jahren  war im Coronajahr 2020 mit  nur 491,7  pro 100.000 Personen – viel niedriger als  im Influenzjahr 2018 mit 785,7 pro 100.000

 Was ist los?
Epoch Times 14 Jan. 2022Die Zahl der Todesfälle bei Menschen im Alter von 18 bis 49 Jahren stieg in den 12 Monaten bis Oktober 2021 im Vergleich zum gleichen Zeitraum 2018–2019 vor der Pandemie um mehr als 40 Prozent, so eine Analyse von The Epoch Times zu Sterbeurkundendaten der Centers for Disease Kontrolle und Prävention (CDC).

Gesundheitsbehörden in mehreren Bundesstaaten mit einigen der größten Zuwächse untersuchen das Problem.

The District of Columbia verzeichnete einen Anstieg von 72 %, nichts davon wurde COVID-19 zugeschrieben.
Nevada sah 65%, von denen nur 36 Prozent COVID-19 zugeschrieben wurden.
In Texas stieg die Sterblichkeit im Alter von 18 bis 49 Jahren um 61 %. Davon wurden weniger als 58 Prozent COVID-19 zugeschrieben.
Arizona verzeichnete einen Anstieg von 57%, von dem 37 Prozent auf COVID-19 zurückgeführt wurden.
Florida, das einen Anstieg von 51% verzeichnete, 48 Prozent davon wurden COVID-19 zugeschrieben, untersucht die Angelegenheit ebenfalls.

Bei den 50- bis 84-Jährigen stieg die Sterblichkeit um mehr als 27%, was mehr als 470.000 zusätzlichen Todesfällen entspricht. Bei etwa 77 Prozent der Todesfälle war COVID-19 auf der Sterbeurkunde als Ursache oder mitwirkender Faktor vermerkt.

Die Covid-Diagnose sagt jedoch nichts aus: Dieses Virus existiert nicht – und die PCR-Methode wurde jetzt von den US-CDC als unbrauchbar aufgegeben: Sie kann nicht zwischen „Covid19“ und Influenza A und B und mehr unterscheiden.
Außerdem ist es eine offensichtliche Lüge, dass 90 % der Todesfälle in den USA auf nicht vorhandenes „Covid“ zurückzuführen sein sollten.

Die Epoch Times vermutet, dass Drogen teilweise die Ursache seien (aufgrund der Isolation).

Aber die Epoch Times vermeidet es sorgfältig, die wahrscheinlichsten Ursachen zu nennen: „Covid-Genmanipulation „Impfstoff“- Zerstörung des ImmunsystemsVAIDS -und Antikörper-abhängige (Schadens)Verstärkung und hier.

Hämorrhagische Fieberepidemie in China nächste Plandemie – nochmals durch olympische Spiele zu verbreiten? Nachrichtensperre seit Weihnachten!

China arbeitet mit Dr. Fauci´s NIAID über Fauci´s Lakai, Peter Daszaks, EcoHealth intim zusammen

Global News 25 Dez. 2021Es ist etwas wirklich Beängstigendes, was in China passiert. China steht kurz davor, uns eine neue Pandemie zu bescherenes könnte ein hämorrhagisches Fieber oder eine neue Variante von COVID-19 sein.  
Athleten und Funktionäre aus der ganzen Welt würden an den Olympischen Winterspielen in China teilnehmen und das (laufende hämorrhagische Fieber)Virus möglicherweise von China in ihre Gastländer exportieren.

China lügt wieder einmal. Und um ehrlich zu sein – wenn Menschen in Xi’an oder in China versuchen, Alarm zu schlagen, würde die KPCh sie töten.

Wenn es um das Etikett „nicht lebensbedrohlich“ (sagen die chinesischen Behörden) des hämorrhagischen Fiebers geht, sollte sogar das Coronavirus eine harmlose Krankheit sein, die Menschen nicht aufeinander übertragen können.
Das Nächste was passieren könnte, wäre, dass die Welt über die Verhängung von Sperren wegen der Verbreitung von hämorrhagischem Fieber sprechen könnte.

Hämorrhagische Fieber-Epidemie in Nordchina – 3 Multimillonenstädte in totalem Lockdown mit Ausgangssperre. Angeblich nur wenige Fälle
Es wird befürchtet, das China genau so wenig wie im Fall des Wuhan-Virusausbruchs die Epidemie in Grenzen halten und durch Schweigen eine neue und schlimmere Pandemie auslösen könne. 
Die doppelte Gefahr eines Covid-19-Ausbruchs und tödlicher hämorrhagischer Fieberfälle hat die nordwestchinesische Stadt Xi´an veranlasst, die Schule auszusetzen und stadtweite Coronavirus-Tests zu starten.

Es gibt übrigens ein Pendant zum Wuhan-Ausbruch: Als das „Covid19″/ MERS Virus sich verbreitete, wurde im Oktober 2019  Miltär-olympische Spiele in Wuhan abgehalten – und die Teilnehmer verbreiteten das Virus in die ganze Welt. Nun stehen in Peking die olympischen Winterspiele bevor!  

Aus China selbst kommen beunruhigende Meldungen – aber seit Weihnachten keine Meldungen mehr!!: 

Global Times (China) 23 Dez. 2021: Viele unklare Ansteckungsketten: Haemorrhagisches Fieber zeigt Notwendigkeit der Lockdown vor olympischen Winterspielen.

Chinesische Analysten sagten, dass Xi´an vor der doppelten Herausforderung von COVID-19-Haufeninfektionen und der Ausbreitung von hämorrhagischem Fieber stehe, einer akuten Infektionskrankheit, die durch Fieber, Blutungen und Nierenschäden gekennzeichnet ist und zum Tod führen kann.
Diese Krankheit hat  im Frühstadium ähnliche Symptome wie COVID-19.
Mehr bei Wikipedia

Seit dem ersten Fall am 9. Dezember hat Xi’an innerhalb von zwei Wochen 234 bestätigte Fälle gemeldet. Am Mittwoch wurden 127 neu entdeckte positive Fälle verzeichnet, die höchste Zahl an einem einzigen Tag.

China hat seit der neuen Epidemie drei große Städte mit über 10 Millionen Einwohnern erlebt, die stadtweite Abriegelungen verhängt haben, obwohl die Abriegelungsmaßnahmen nicht so streng sind wie in Wuhan Anfang 2020.
Ab Donnerstag mussten die 13 Millionen Einwohner von Xi’an drinnen bleiben.

Die Regierung von Xi’an sagte am Mittwoch, dass versteckte Übertragungen in Xi’an zu Übertragungen in der Gemeinschaft geführt hätten, und dass die Epidemie auf andere Provinzen und Städte, einschließlich Peking, übergegriffen habe

Chinesische Experten für öffentliche Gesundheit sprechen von einer düsteren und komplizierten epidemischen Situation.

„Experten“  mutmassen nun in den Lügenmedien, Omicron könnte das Ende der Plandemie sein, obwohle ihre Freimaurerdirektoren wohl das Gegenteil wissen.

Das zu glauben ist aber naïv:

Die Elite plant, Plandemien bis zum mindestens Jahr 2023 weiterzuführen  

Rothschilds Weltbank plant akute Covid19-Bekämpfung bis 2025 und Grossbritannien hat bis 2023 Covid19 Propaganda bestellt

Beachten Sie, dass das Projekt zur Dringlichkeits-Abhilfe der Weltbank von Covid19 bis zum Jahr 2025 läuft – das heißt, die Weltbank erwartet, dass die Bekämpfung von “Covid19” bis zum Jahr 2025 fortgesetzt werde – wie auch von Nature und Science projiziert.

Kein Wunder – denn diese Plandemie und hier und hier Wuhaepidemie war 40 jahrelang geplant.

Man kann  den Verdacht hegen, dass die Elite einen Ablöser für das milde Omicronvirus vorbereitet. Und sicher mehrere – immer aggressiver. Denn sie plant ja offensichtlich jahrelange Verlängerung der ihnen sehr nützlichen Plandemiediktatur. Als Brutstelle ist China  immer bereit – in Zusammenarbeit mit Fauci´s NIAID.

Dr Robert Malone, Erfinder der mRNA-„Impfung“, warnt, dass  eine sich enwickelnde hämorragische Fieber-Epidemie in Nord-China ein neues Wuhan werden könne.

Als Kommentar zu den Berichten sagte Malone: „Sie verwenden die Sprache, dass dies ein hämorrhagisches Fiebervirus ist. Wenn das der Fall ist, wäre es sehr seltsam, dass dies etwas ist, was durch ein Coronavirus verursacht wird. Diese Terminologie wird normalerweise für Viren der Familie Marburg und Ebola verwendet.

Tagesschau 4. Jan. 2022: Die olympischen Winterspiele sollen komplett in einer Blase stattfinden. Ausländischer Zuschauer sind keine zugelassen –  und nur wenige Staatsgäste aus dem Ausland.

China will auf jeden Fall verhindern, dass die Sportlerinnen und Sportler das Coronavirus ins Land tragen und verbreiten. Vor allem vor der ansteckenderen Omikron-Variante dürfte sich die Staats- und Parteiführung fürchten, da jetzt klar ist, dass die chinesischen Impfstoffe nicht vor einer Ansteckung schützen

Gibt es in Nordchina eine Epidemie mit hämorrhagischem Fieber?

Millionen leben nun in Quarantäne-Camps – es sind Gefängnisse, sogar für Kinder 

 

Bemerkung
Es ist schwierig, den Umfang der hämorrhagischen Fieber-Epidemie Xi´ans in diesem geschlossenen Diktaturland zu beurteilen.

Hämorrhagisches Fieber ist laut Wikipedia endemisch in Osteuropa und Asien, Angeblich keine Epidemie vor einem Jahr.

Vielleicht geht es gar nicht um eine ansteckende Epidemie – sondern um antikörperabhängige Schadensverstärkung und hier durch Immunüberreaktion auf mRNA-produziertes Spike-Protein nach den vielen „Covid19“-Impfungen oder VAIDS- Immunschächung 

 

Heute noch aktuell:“Lüge nur aufrecht zu erhalten, solange der Staat das Volk vor deren Folgen schützen kann. Wahrheit grösster Staatsfeind und muss mit allen Mitteln bekämpft werden“

Plötzlich explosiv steigende Sterblichkeit in 95% Omicron/Covid19 Epidemie- obwohl Omicron nur 115 Personen global getötet hat. 87% Infizierter Geimpft. Impfbezogene antikörperverbundene Schadensverstärkung liegt nahe

Etwas Sonderbares ereignet sich zur Zeit: Tagtäglich neue „Covid19-Ansteckungsrekorde“. In Deutschland und Österreich führen die Machthaber immer mehr Restriktionen – sogar Zwangsimpfungen – ein.
In Dänemark, dagegen, lockert man die Restriktionen kräftig – mit der Begründung, dass die Todesfälle ja bloss wie in üblichen Grippensaisonen sind.

Ursache: Das milde Omicron-Virus (und Influenza A und B, die laut den US-CDC mit dem unbrauchbaren, unspezifischen PCR-Test auch als „Covid19 mitgerechnet werden, weshalb  die USA  und Schweden diese Metode aufgegeben haben.

In DK macht „Omicron“ etwa 95% der „Covid-Fälle“ aus. Graph unten)

Omicron-Angesteckte nach Impfstatus verteilt
87% der Infizierten sind geimpft! 

Nun meldet sich die Frage: Wie Tödlich ist das Omicron-Virus?
The Economic Times News 12. Jan. 2022:  Weltweit starben bisher insgesamt 115 Menschen an der Omicron-Variante von COVID-19, von denen ein Todesfall in Indien gemeldet wurde, teilte Lav Agarwal, gemeinsamer Sekretär des Gesundheitsministeriums der Union, am Mittwoch mit.

Unterdessen verzeichnete Indien in den letzten 24 Stunden bis zu 1.94.720 neue COVID-19-Infektionen und 442 Todesfälle, teilte das Ministerium für Gesundheit und Familienfürsorge am Mittwoch mit“.

Wir sehen hier ein großes Paradox: Global 115 Tote an der fast alleinherrschenden Omicron-Epidemie,- und gleichzeitig innerhalb von 24 Stunden 442 neue Todesfälle in Indien!

Was geht eigentlich vor sich?

Our World in Data: Seit Sept. 2021 bis zum 12. Jan 2022 stabile Neue „Covid19“-Zahlen. Dann am 12. Jan. plötzliche Explosion.

Zum Vergleich seit 2020: Sie sehen, dass die 12. Jan. Explosion 2021 nicht vorkam.
Etwas Neues ist eingetroffen: Resistenz oder antistoffabhängige (Schadens)verstärkung?

Sehen wir uns nun die Todesstatistiken  des Worldometers an: Während es mit Ausnahme von Brasilien zur Zeit global nur ein schwache Tendenz nach oben Gibt – gibt es in den am meisten Geimpften Staten Graph (unten) plötzlich einen steilen Anstieg

Bemerkung
Da das herrschende Omicron so wenige Todesfälle auslöst, muss es einen anderen Grund für die abrupt steigende Sterblichkeit unter den „Covid19“-Angesteckten geben.

Da fallen mir nur noch die katastrophalen vakzinausgelösten Schäden in der Form von antikörperabhängiger (Schadens)Verstärkung ein: Diese Schäden bestehen aus kräftigen Reaktionen des Körpers gegen die Vakzin-mRNA  geschädigten Zellen in den Gefässwänden überall im Körper mit Blutpfropfen zur Folge: Mikrothrombosen bei 62% der Geimpften, sowie in lebenswichtigen Organen wie Lungen, Nieren, Herzen, Hirn usw.

Teils verschlingen T-Lymphozyten die geschädigten Zellen, die nach infektion durch die mRNA nun auch Spikeprotein produzieren – teils kann Überproduktion  der eigenen Antistoffe gegen das durch injizierte mRNA produzierte Spikeprotein in den Zellen Autoimmunkrankheit auslösen: Eigene Gewebe werden Antigene für eigene Antistoffe. In schlimmsten Fällen finden Zytokinstürme statt und töten den Geimpften.

Das alles erklärt Prof. Bakhdi hervorragend: Hören Sie von 17.“% Minuten sowie hier und  hier

„Ihre Hybris hat aus Macht-, Budget- und Kontrollgier unsere Leben ruiniert. Aber nun wird die Wahrheit schliesslich offenkundig“: Offener Brief von israelischer Mikrobiologie-Professor an Pandemie-Politiker und Ärzte

Offener Brief von Professor Ehud Qimron, Leiter der Abteilung für Mikrobiologie und Immunologie an der Universität Tel Aviv und einer der führenden israelischen Immunologen, hat einen offenen Brief verfasst, in dem er  das israelische – und tatsächlich globale – Management der Coronavirus-Pandemie scharf kritisiert.

Siehe auch: Professor Qimrons Vorhersage vom August 2020: „Die Geschichte wird über die Hysterie urteilen“ (INN).

∗∗∗

Gesundheitsministerium, es ist Zeit, Ihr Versagen einzugestehen
Am Ende wird immer die Wahrheit ans Licht kommen, und die Wahrheit über die Coronavirus-Politik beginnt sich zu enthüllen.

Zwei Jahre zu spät erkennen Sie schließlich, dass ein Atemwegsvirus nicht besiegt werden kann und dass jeder derartige Versuch zum Scheitern verurteilt ist. Sie geben es nicht zu, weil Sie in den letzten zwei Jahren fast keinen Fehler eingestanden haben, aber im Nachhinein ist klar, dass Sie in fast allen Ihren Handlungen kläglich gescheitert sind, und selbst die Medien haben bereits Mühe, Ihre Scham zu vertuschen.

Sie weigerten sich zuzugeben, dass die Infektion trotz jahrelanger Beobachtungen und wissenschaftlicher Erkenntnisse in Wellen auftritt, die von selbst abklingen. Sie haben darauf bestanden, jeden Rückgang einer Welle ausschließlich Ihren Handlungen zuzuschreiben, und so haben Sie durch falsche Propaganda „die Pest überwunden“. Und wieder haben Sie sie besiegt, und wieder und wieder und wieder.

Sie haben sich geweigert zuzugeben, dass Massentests unwirksam sind, obwohl Ihre eigenen Notfallpläne dies ausdrücklich vorgeben („Pandemic Influenza Health System Preparedness Plan, 2007“, S. 26).

Sie weigerten sich zuzugeben, dass die Genesung schützender ist als ein Impfstoff, obwohl frühere Erkenntnisse und Beobachtungen zeigten, dass nicht genesene geimpfte Personen mit größerer Wahrscheinlichkeit infiziert werden als genesene Personen.

Sie wollten trotz der Beobachtungen nicht zugeben, dass die Geimpften ansteckend sind. (Sogar 251-mal grössere Viruslast im Rachen bei Reinfektion be Geimpften als bei Reinfektierer Ungeimpften) Darauf aufbauend hofften Sie, durch Impfung eine Herdenimmunität zu erreichen – und auch daran sind Sie gescheitert.

Sie haben sich geweigert, die von mehr als 60.000 Wissenschaftlern und Medizinern unterzeichnete „Barrington-Erklärung“ oder andere Programme des gesunden Menschenverstandes anzunehmen. Sie haben sich entschieden, sie lächerlich zu machen, zu verleumden, zu verzerren und zu diskreditieren. Anstelle der richtigen Programme und Personen haben Sie Fachleute ausgewählt, denen es an einer entsprechenden Ausbildung für das Pandemiemanagement mangelt.

Sie haben kein wirksames System zur Meldung von Nebenwirkungen der Impfstoffe eingerichtet, und Berichte über Nebenwirkungen wurden sogar von Ihrer Facebook-Seite gelöscht. Ärzte vermeiden es, Nebenwirkungen mit dem Impfstoff in Verbindung zu bringen, damit Sie sie nicht verfolgen, wie Sie es mit einigen ihrer Kollegen getan haben.

Stattdessen haben Sie sich dafür entschieden, zusammen mit leitenden Pfizer-Führungskräften unsachliche Artikel über die Wirksamkeit und Sicherheit von Impfstoffen zu veröffentlichen.

Irreversibler Vertrauensschaden

Allerdings haben Sie aus der Höhe Ihrer Hybris auch die Tatsache ignoriert, dass am Ende die Wahrheit ans Licht kommt.

Und sie beginnt sich zu offenbaren. Die Wahrheit ist, dass Sie das Vertrauen der Öffentlichkeit in Sie auf einen beispiellosen Tiefpunkt gebracht und Ihren Status als Quelle der Autorität untergraben haben. Die Wahrheit ist, dass Sie Hunderte Milliarden Schekel vergeblich verbrannt habenfür die Veröffentlichung von Einschüchterungen, für ineffektive Tests, für zerstörerische Lockdowns und für die Störung des Alltags in den letzten zwei Jahren.

Sie haben die Bildung unserer Kinder und ihre Zukunft zerstört. Sie haben Kinder dazu gebracht, sich schuldig zu fühlen, Angst zu haben, zu rauchen, zu trinken, süchtig zu werden, abzubrechen und sich zu streiten, wie Schulleiter im ganzen Land bestätigen. Sie haben Lebensgrundlagen, die Wirtschaft, die Menschenrechte, die geistige Gesundheit und die körperliche Gesundheit geschädigt.

Sie haben Kollegen verleumdet, die sich Ihnen nicht ergeben haben, Sie haben die Menschen gegeneinander aufgebracht, die Gesellschaft gespalten und den Diskurs polarisiert. Sie brandmarkten ohne wissenschaftliche Grundlage Menschen, die sich gegen eine Impfung entschieden haben, als Feinde der Öffentlichkeit und als Verbreiter von Krankheiten.

Sie fördern auf beispiellose Weise eine drakonische Politik der Diskriminierung, der Verweigerung von Rechten und der Auswahl von Menschen, einschließlich Kinder, für ihre medizinische Wahl. Eine Auswahl, die jeder epidemiologischen Begründung entbehrt.

Die von Ihnen verursachte Zerstörung hat nur Opfer hinzugefügt , die über die Anfälligen für das Virus hinausgehen: Die Wirtschaft, die Sie ruiniert haben, die Arbeitslosigkeit, die Sie verursacht haben, und die Kinder, deren Zukunft Sie ruiniert haben.

Es liegt derzeit kein medizinischer Notfall vor,
aber Sie kultivieren einen solchen Zustand seit zwei Jahren aus Macht-, Budget- und Kontrollgier
. Der einzige Notfall ist jetzt, dass Sie immer noch Richtlinien festlegen und riesige Budgets für Propaganda und psychologische Technik bereithalten, anstatt sie dafür anzuweisen, das Gesundheitssystem zu stärken.

Dieser Notstand muss aufhören!

Professor Udi Qimron, Medizinische Fakultät, Universität Tel Aviv

Elite jubelt: Schwächelnde Kampfmoral gegen ihren PCR-Plandemie. Spanien kapituliert vor der „Covid19“, stuft es auf eine gewöhnliche Grippe herab. BBC und Prof. Streeck neigen auch zum Abfall

BBC-Video: Beginnt sogar die globalistische und impfpropagandische BBC zu verstehen, dass die „Covid19“ Plandemie des PCR-Schwindels nicht nachhaltig zu bekämpfen ist?
In einer Sendung wird die Wahrheit über die „Covid19“-Auswirkungen an ein gehirngewaschenes Publikum  ausgestrahlt, dem jahrelang das absolute Gegenteil  ins Hirn eingegossen worden ist.

Und Focus meldet Spaniens Kapitulation
Focus 11.01.2022:

Sogar der bonner Virologe, Prof. Hendrick Streeck drückt defaitistische Gedanken aus:


Mit aktuell rund 200.000 Neuinfektionen pro Tag und einer Sieben-Tage-Inzidenz von 1.600 schwappt die Omikron-Welle derzeit über Spanien. Trotzdem erwägt die Regierung offenbar, das Coronavirus zukünftig wie die klassische Grippe-Erkrankung zu behandeln.

Laut der Tageszeitung „El Pais“ will die Regierung künftig nicht mehr jede Corona-Infektion registrieren und nachverfolgen. Dabei soll künftig auch nicht jede Person mit Symptomen getestet werden.

Konkret soll das bedeuten, dass ein sogenanntes „Sentinelsystem“ – ähnlich wie bei der Grippe – statt einer Komplettüberwachung der Fälle errichtet werden soll, in dem nur ausgewählte Gesundheitszentren, Hausärzte und Krankenhäuser Daten zur Ausbreitung des Coronavirus erheben.

Doch wird besonders aktuell deutlich, dass Spanien in der Nachverfolgung an Grenzen stößt: „Angesichts der enormen Übertragbarkeit von Covid ist es jetzt sehr schwierig, die universellen Überwachungsprotokolle strikt einzuhalten, es wird unmöglich“, erklärt Amparo Larrauri, Leiterin der Überwachungsgruppe für Influenza und andere Atemwegsviren bei der Gesundheitsbehörde.

Bis auf die Maskenpflicht im Freien hat Spanien kaum noch geltende Corona-Maßnahmen. Die Regierung hat zudem die Quarantäne für Geimpfte abgeschafft.

Erkrankte müssen sich in der Regel nur noch sieben Tage lang isolieren. Direkte Kontaktpersonen müssen nicht mehr getestet werden, wenn sie keine Symptome haben.

Die vielen Fälle in der Bevölkerung spiegeln sich auch in den Krankenhäusern wieder. Am Freitag waren es 14.426 Fälle, davon befanden sich 2.056 (0.01% der Bevölkerung!!) auf der Intensivstation. Pro Tag kommen landesweit rund 170 Patienten dazu. In einigen Regionen sind die Intensivstationen zu mehr als 40 Prozent mit Covid-Infizierten belegt.

Bemerkung

Und die Elite hinter der NWOPlandemie und hier und hier und hier jubelt: Die Gesellschaften zerbröckeln moralisch genau wie geplant.

Eines können Sie sicher sein: Wenn das Omicron ausbrennet. hat die Eliter noch ein ein schlimmeres Virus für uns bereit – denn das ewige Boostern schafft an sich immer resistentere Virenr resistentere!